Dna sequence shows a gene encoding a smallpolypeptide

Impact of pollution in lake washington
August 4, 2017
Solution-Analyze role of microbes in human disease and
August 4, 2017
Show all

Dna sequence shows a gene encoding a smallpolypeptide

The following DNA sequence shows a “gene” encoding a smallpolypeptide. The start codon is AUG and the three “stop” codons are UAA, UAG, and UGA. The promoter region of the DNA is inparetntheses.

5′ (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3′
3′ (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5′

using the mRNA codon chart, transcribe and translate the”gene” from above.

a) which DNA strand did you choose as the template strand? Topor bottom? Why?

b) mRNA sequence (not including promoter region)=

c) mRNA sequence from start to stop codon=

d) anticodons for each codon=

e) amino acid sequence (including start amino)=

Leave a Reply

Your email address will not be published. Required fields are marked *